Review



human sox9 overexpression vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc human sox9 overexpression vector
    Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) <t>SOX9</t> labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.
    Human Sox9 Overexpression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+sox9+overexpression+vector/pLV%2ECMV%2EGFPmiR125sponge+(Plasmid+%23115974)/pm31433983-223-250-248
    Average 91 stars, based on 1 article reviews
    human sox9 overexpression vector - by Bioz Stars, 2026-09
    91/100 stars

    Images

    1) Product Images from "Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness."

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    Journal: Cell reports

    doi: 10.1016/j.celrep.2019.07.071

    Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.
    Figure Legend Snippet: Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.

    Techniques Used: Activation Assay, Activity Assay, Expressing, Labeling

    Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.
    Figure Legend Snippet: Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.

    Techniques Used: Over Expression, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Cotransfection, Construct, Control

    Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.
    Figure Legend Snippet: Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.

    Techniques Used: Isolation, Transduction, Luciferase, Expressing, Imaging, Marker, Plasmid Preparation, Stable Transfection, Control, Incubation, Western Blot, Labeling

    Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.
    Figure Legend Snippet: Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.

    Techniques Used: Over Expression, Expressing, Control

    Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.
    Figure Legend Snippet: Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.

    Techniques Used: Over Expression, Control

    Related Articles

    Expressing:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Polymerase Chain Reaction:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Sequencing:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Recombinant:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Plasmid Preparation:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Over Expression:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Clone Assay:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Activation Assay:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Activity Assay:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Labeling:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Real-time Polymerase Chain Reaction:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Western Blot:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Luciferase:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Cotransfection:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Construct:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Control:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Isolation:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Transduction:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Imaging:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Marker:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Stable Transfection:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Incubation:

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).



    Similar Products

    91
    Addgene inc human sox9 overexpression vector
    Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) <t>SOX9</t> labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.
    Human Sox9 Overexpression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+sox9+overexpression+vector/pLV%2ECMV%2EGFPmiR125sponge+(Plasmid+%23115974)/pm31433983-223-250-248
    Average 91 stars, based on 1 article reviews
    human sox9 overexpression vector - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.

    Journal: Cell reports

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    doi: 10.1016/j.celrep.2019.07.071

    Figure Lengend Snippet: Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Techniques: Activation Assay, Activity Assay, Expressing, Labeling

    Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.

    Journal: Cell reports

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    doi: 10.1016/j.celrep.2019.07.071

    Figure Lengend Snippet: Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Techniques: Over Expression, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Cotransfection, Construct, Control

    Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.

    Journal: Cell reports

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    doi: 10.1016/j.celrep.2019.07.071

    Figure Lengend Snippet: Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Techniques: Isolation, Transduction, Luciferase, Expressing, Imaging, Marker, Plasmid Preparation, Stable Transfection, Control, Incubation, Western Blot, Labeling

    Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.

    Journal: Cell reports

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    doi: 10.1016/j.celrep.2019.07.071

    Figure Lengend Snippet: Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Techniques: Over Expression, Expressing, Control

    Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.

    Journal: Cell reports

    Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

    doi: 10.1016/j.celrep.2019.07.071

    Figure Lengend Snippet: Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

    Techniques: Over Expression, Control